Adenosine Deaminase Defficiency
                                                                       By Brian Keesey
                                                                         Genetics 3431

     Adenosine deaminase (ADA) is a glycoprotein that catalyzes the hydrolytic deamination of adenosine into inosine.  A deficiency of ADA can lead to severe combined immunodeficiency (SCID). Adenosine Deaminase detoxifies pharmacologically active adenosine (due to ADA’s hydrolase nature). Polyethylene glycol is then covalently bonded to adenosine deaminase and immunity is diminished. ADA deficiency is the cause for at least 30% of all SCID cases (1).  Conversely, an excess of adenosine deaminase leads to hemolytic anemia.  Patients who lack both of the ADA genes fail to develop adequate B cells and T cells are left with inadequate immunity.  ADA deficiency has been a good candidate for gene therapy due to its cloning for reinsertion studies.
 The ADA gene is autosomal recessive and is located on chromosome 20 (20q12-q13).   Immunodeficiency state of this enzyme was first reported by Valentine et al. (1977) (2).  Structural changes (i.e. point mutations) have been identified on the ADA gene.  Gene dosage studies of ADA suggested that the deficiency is partly related to a trisomy involved with chromosome 20 (possibly a familial translocation).   In studies performed concerning somatic cell hybrids, it was found that structural gene mutations at the ADA locus were the primary cause of ADA deficient SCID (3).
 Spencer et al (1968) (3) demonstrated that there are three different genetically determined phenotypes for the ADA deficiency. These include ADA 1, ADA 2-1, and ADA 2.  Type one and two are distinguished by respective deficiencies of the ADA gene.  The third type is associated with ADA excess (anemia).  The ADA 2 phenotype was found to be estimated at .06 in Europeans, .11 in Asiatic Indians, and .04 in Blacks.  Adenosine Deaminase ha¸s been used recently in diagnosing Mycobacterium tuberculosis.  It has been discovered that patients with Mycobacterium tuberculosis have elevated ADA levels (above 50IU/L). Lauter and Tram have stated that ADA has a role in modulating neuron membrane permeability and cellular excitability (4). The amino acid sequence of ADA has been determined and is comprised of the following 361 amino acids (5):

---

                        1 Met Ala Gln Thr Pro Ala Phe Asp Lys Pro Lys Val Glu Leu His    15
                        16 Val His Leu Asp Gly Ser Ile Lys Pro Glu Thr Ile Leu Tyr Tyr    30
                        31 Gly Arg Arg Arg Gly Ile Ala Leu Pro Ala Asn Thr Ala Glu Gly    45
                        46 Leu Leu Asn Val Ile Gly Met Asp Lys Pro Leu Thr Leu Pro Asp    60
                        61 Phe Leu Ala Lys Phe Asp Tyr Tyr Met Pro Ala Ile Ala Gly Cys    75
                        76 Arg Glu Ala Ile Lys Arg Ile Ala Tyr Glu Phe Val Glu Met Lys    90
                        91 Ala Lys Glu Gly Val Val Tyr Val Glu Val Arg Tyr Ser Pro His   105
                       106 Leu Leu Ala Asn Ser Lys Val Glu Pro Ile Pro Trp Asn Gln Ala   120
                       121 Glu Gly Asp Leu Thr Pro Asp Glu Val Val Ala Leu Val Gly Gln   135
                       136 Gly Leu Gln Glu Gly Glu Arg Asp Phe Gly Val Lys Ala Arg Ser   150
                       151 Ile Leu Cys Cys Met Arg His Gln Pro Asn Trp Ser Pro Lys Val   165
                       166 Val Glu Leu Cys Lys Lys Tyr Gln Gln Gln Thr Val Val Ala Ile   180
                       181 Asp Leu Ala Gly Asp Glu Thr Ile Pro Gly Ser Ser Leu Leu Pro   195
                       196 Gly His Val Gln Ala Tyr Gln Glu Ala Val Lys Ser Gly Ile His   210
                       211 Arg Thr Val His Ala Gly Glu Val Gly Ser Ala Glu Val Val Lys   225
                       226 Glu Ala Val Asp Ile Leu Lys Thr Glu Arg Leu Gly His Gly Tyr   240
                       241 His Thr Leu Glu Asp Gln Ala Leu Tyr Asn Arg Leu Arg Gln Glu   255
                       256 Asn Met His Phe Glu Ile Cys Pro Trp Ser Ser Tyr Leu Thr Gly   270
                       271 Ala Trp Lys Pro Asp Thr Glu His Ala Val Ile Arg Leu Lys Asn   285
                       286 Asp Gln Ala Asn Tyr Ser Leu Asn Thr Asp Asp Pro Leu Ile Phe   300
                       301 Lys Ser Thr Leu Asp Thr Asp Tyr Gln Met Thr Lys Arg Asp Met   315
                       316 Gly Phe Thr Glu Glu Glu Phe Lys Arg Leu Asn Ile Asn Ala Ala   330
                       331 Lys Ser Ser Phe Leu Pro Glu Asp Glu Lys Arg Glu Leu Leu Asp   345
                       346 Leu Leu Tyr Lys Ala Tyr Gly Met Pro Pro Ser Ala Ser Ala Gly   360
                       361 Gln Asn Leu
   Figure 1- ADA Amino Acid Sequence  (3-letter code)

---

   1          11         21         31         41         51
    1 MAQTPAFDKP KVELHVHLDG SIKPETILYY GRRRGIALPA NTAEGLLNVI GMDKPLTLPD    60
   61 FLAKFDYYMP AIAGCREAIK RIAYEFVEMK AKEGVVYVEV RYSPHLLANS KVEPIPWNQA   120
  121 EGDLTPDEVV ALVGQGLQEG ERDFGVKARS ILCCMRHQPN WSPKVVELCK KYQQQTVVAI   180
  181 DLAGDETIPG SSLLPGHVQA YQEAVKSGIH RTVHAGEVGS AEVVKEAVDI LKTERLGHGY   240
  241 HTLEDQALYN RLRQENMHFE ICPWSSYLTG AWKPDTEHAV IRLKNDQANY SLNTDDPLIF   300
  301 KSTLDTDYQM TKRDMGFTEE EFKRLNINAA KSSFLPEDEK RELLDLLYKA YGMPPSASAG   360
  361 QNL
  Figure 2- ADA Amino Acid Sequence (1-letter code)

---

atggcccaga cgcccgcctt cgacaagccc aaagtagaac tgcatgtcca   cctagacgga        60
tccatcaagc ctgaaaccat cttatactat ggcagggaca agccgctcac ccttccagac       120
   ttcctggcca agtttgacta ctacatgcct gctatcgcgg gctgccggga ggctatcaaa       180
aggatcgcct atgagtttgt agagatgaag gccaaagagg gcgtggtgta tgtggaggtg       240
cggtacagtc cgcacctgct ggccaactcc aaagtggagc caatcccctg gaaccaggct       300
gaaggggacc tcaccccaga cgaggtggtg gccctagtgg gccagggcct gcaggagggg       360
gagcgagact tcggggtcaa ggcccggtcc atcctgtgct gcatgcgcca ccagcccatc       420
     ttgcctggac atgtccaggc ctaccaggag gctgtgaaga gcggcattca ccgtactgtc       480
     cacgccgggg aggtgggctc ggccgaagta gtaaaagagg ctgtggacat actcaagaca       540
gagcggctgg gacacggcta ccacaccctg gaagaccagg ccctttataa caggctgcgg       600
     caggaaaaca tgcacttcga gatctgcccc tggtccagct acctcactgg tgcctggaag       660
ccggacacgg agcatgcagt cattcggctc aaaaatgacc aggctaacta ctcgctcaac       720
acagatgacc cgctcatctt caagtccacc ctggacactg attaccagat gaccaaacgg       780
     gacatgggct ttactgaaga ggagtttaaa aggctgaaca tcaatgcggc caaatctagt       840
ttcctcccag aagatgaaaa gagggagctt ctcgacctgc tctataaagc ctatgggatg       900
ccaccttcag cctctgcagg gcagaacctc tga                                    933

   Figure 3-ADA Sequence

---

The following are exons that are involved in ADA deficiency:

   (Exon 1)
    1 tccaggaaat gcgcgatcca ggccggcggg cggggcgggg gctccggcga gagggcgggc
  61cccgggaacg gcggcgggcg gggcgggagg cggggcccgg cccgttaaga agagcgtggc
121cggccgcggc caccgctggc cccagggaaa gccgagcggc caccgagccg gcagagaccc
181accgagcggc ggcggaggga gcgacgccgg ggcgcacgag ggcaccatgg cccagac
241 cgccttcgac aagcccaaag tgagcgcgcg cg

(Exon 2)
1 gtagaactgcatgtccacct agacggatcc atcaagcctg aaaccatctt atactatggc
61 ag

            (Exon 3)
 1 ggacaagccg ctcacccttc cagacttcct ggccaagttt gactactaca tgcctgctat
61 cgc

    (Exon 4)
    1 cccctttctt cccttcccag gggctgccgg gaggctatca aaaggatcgc ctatgagttt
  61 gtagagatga aggccaaaga gggcgtggtg tatgtggagg tgcggtacag tccgcacctg
121 ctggccaact ccaaagtgga gccaatcccc tggaaccagg ctgagtgagt gatgggcctg
181 gaagg

  (Exon 5)
   1 ctcctctcct cacacagagg ggacctcacc ccagacgagg tggtggccct agtgggccag
 61 ggcctgcagg agggggagcg agacttcggg gtcaaggccc ggtccatcct gtgctgcatg
121 cgccaccagc ccagtgagta ggatcaccgc cctgcccagg gcgcccgtct caccctggcc
181 ct

           (Exon 6)
 1 tctcgcccac agactggtcc cccaaggtgg tggagctgtg taagaagtac cagcagcaga
 61 ccgtggtggc cattgacctg gctggagatg agaccatccc aggaagcagc ctcttgcctg
 121 gacatgtcca ggcctaccag gtgggtcctg tgagaaggaa tggagagg

           (Exon 7)
1 gaggctgtga agagcggcat tcaccgtact gtccacgccg gggaggtggg ctcggccgaa
61 gtagtaaaag ag

(Exon 8)
1 gctgtggaca tactcaagac agagcggctg ggacacggct accacaccct ggaagaccag
61 gccctttata acaggctgcg gcaggaaaac atgcacttcg ag

(Exon 9)
1 ccacacacct gctcttccag atctgcccct ggtccagcta cctcactggt gcctggaagc
61 cggacacgga gcatgcagtc attcggtgag ctctg

          (Exon 10)
1 ctgcaggctc aaaaatgacc aggctaacta ctcgctcaac acagatgacc cgctcatctt
61 caagtccacc ctggacactg attaccagat gaccaaacgg gacatgggct ttactgaaga
121 ggagtttaaa aggctggtga gtgg

          (Exon 11)
1 gccattctgg cctttccaga acatcaatgc ggccaaatct agtttcctcc cagaagatga
61 aaagagggag cttctcgacc tgctctataa agcctatggg atgccacctt cagcctctgc
121 aggtaggttc ctgtctgggc ttctgggcag ttgcc

         (Exon 12)
ggcagaacct ctgaagacgc cactcctcca agccttcacc ctgtggagtc accccaactc        60
tgtggggctg agcaacattt ttacatttat tccttccaag aagaccatga tctcaatagt       120
cagttactga tgctcctgaa ccctatgtgt ccatttctgc acacacgtat acctcggcat       180
ggccgcgtca cttctctgat tatgtgccct ggccagggac cagcgccctt gcacatgggc       240
atggttgaat ctgaaaccct ccttctgtgg caacttgtac tgaaaatctg gtgctcaata       300
aagaagccca tggctggtgg cat                                               323

    Management of ADA deficiency includes bone marrow transplants accompanied by gene therapy.  The additional use of PEG-ADA enzyme replacement is being studied to assess its role in the management of ADA deficiency.  Herschfeild et al (1987) found that polyethelene glycol-modified ADA is effective in diminishing immunogenicity by attacking degradative enzymes and therefore prolonging plasma life (6).  One series involved treatment of T cells, the other used B and T cells from peripheral blood with one construct and marrow cells with another ADA construct. The T cells derived from the peripheral blood were progressively replaced by T cells from the marrow - long term 'cure' but dependent on PEG ADA. Managing ADA deficiency has been a rocky road, but with continuing research and clinical trials involving gene replacement therapy, progress will yield more beneficial treatments.

--------------------------------------------------------------------------------

References:

(1).  IDF, Illinois Chapter, Severe Combined Immunodeficiency (SCID).
Http://www.inil.com/users/lemur/scid.html. (through OMIM)

(2).  Valentine, W.N.; Paglia, D.E.;Tartaglia, A.p.; Gilsanz, F:
Hereditary hemolytic anemia with increased red cell adenosine deaminase and decreased adenosine triphosphate.  Science 195:783-785, 1977

(3).  Spencer, N; Hopkins, D.A; Harris, H:
Adenosine deaminase polymorphism in man. Ann. Hum. Genet. 32: 9-14, 1968

(4).  Trams, E., and Lauter, C.: Adenosine Deaminase of Cultured Brain Cells, Biochem. J., 152,681 (1975).

(5).  SWISS-PROT: p00813, http://www.expasy.ch/cgi-bin/protparam?ADA_HUMAN, Feb 16, 1999

(6).  Hershfield, M, Buckley, R., Greenberg, M., Melton, A., Sciff, R., Haten, C., Kurtzberg, J., Market, M., Kobayashi, A., and Abuchowski, A.: The Treatment of Adenine Deaminase Deficiency with Polyethylene Glycol-Modified Adenosine Deaminase, New Eng. J. Med., 316,589 (1987)

http://www.expasy.ch/sprot/sprot-top.html
http://www3.ncbi.nlm.nih.gov/Omim/